xmlinkhub
Primer Sequences of Chemokines and GAPDH for Real- Time RT-PCR Using... | Download Table
A. Details of PCR primers used for analysis of ureB, napA and mouse... | Download Table
Mouse Positive Control Primer Set Gapdh-2 – MyBio Ireland
MP205604 | Gapdh Mouse qPCR Primer Pair (NM_008084) Clinisciences
Supplementary Table 1. Mouse Primers/probes used in TaqMan real-time PCR. Gene Gene Assay ID number/Primer sequences (5´ to 3´
Primer sequences of target genes and GAPDH for real-time PCR assay | Download Scientific Diagram
Human-specific GAPDH qRT-PCR is an accurate and sensitive method of xenograft metastasis quantification: Molecular Therapy Methods & Clinical Development
Differentiation of Human Embryonic Stem Cells into Cells with Corneal Keratocyte Phenotype | PLOS ONE
Human-specific GAPDH qRT-PCR is an accurate and sensitive method of xenograft metastasis quantification - ScienceDirect
The primer set used for the amplification of mouse GAPDH, P21 and P53. | Download Table
primer set Forward Reverse Gapdh AGGTCGGTGTGAACGGATTTG TGTAGACCATGTAGTTGAGGTCA Arid1a GACCCCTCAGTCATCCAGTC GAGTATGGGTTAGTCCCACCA
Human-specific GAPDH RT-qPCR is an accurate and sensitive method of xenograft metastasis quantification | bioRxiv
cAMP-responsive Element-binding Protein (CREB) and cAMP Co-regulate Activator Protein 1 (AP1)-dependent Regeneration-associated Gene Expression and Neurite Growth* - Journal of Biological Chemistry
Primer sequences for mouse DNMT genes and Gapdh. | Download Table
xmlinkhub
Primer sequences of mouse TLRs and GAPDH for Real-time RT-PCR | Download Scientific Diagram
JCI Insight - Targeting IL-17A/glucocorticoid synergy to CSF3 expression in neutrophilic airway diseases
Mouse/Rat Pluripotent Primer Pair Panel (SC015): R&D Systems
Suitable primers for GAPDH reference gene amplification in quantitative RT-PCR analysis of human gene expression - ScienceDirect
Primer sequences used for RT-PCR in mouse | Download Table
